Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish.

Hosted by @mirimiam.bsky.social

evomedgenomics.com/events/exter...

Last days to apply! Cool project, cool cities! :-)

(Please repost! 🙏)

Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life.
www.nature.com/articles/s41...

🚨🚨🚨 New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social.

www.annualreviews.org/content/jour...

🚨🚨🚨

Please RT!

We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.

Deadline: 30/09/25👇

www.embopress.org/doi/full/10....

"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization".

In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7

tinyurl.com/45k7kbmp

The job call is officially open. If you're interested, please apply through this link ASAP! 😃

www.mdc-berlin.de/career/jobs/...

Please RT! 🙏

🐟 Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social 🐟

A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu

elifesciences.org/reviewed-pre...

Thread 👇1/9

🚨🚨🚨

If you're a bioinformatician who loves:

🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing
🚀 Collaborating and travelling

Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu-@crg.eu in Barcelona. Qs: www.transdevolab.com

Please RT! 🙏

We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab.

www.crg.eu/en/content/t...

"La importancia de apoyar la investigación en España"
👏👏👏
elpais.com/opinion/2024...

‼ Investigadores españoles dan un paso más en descifrar el misterio del autismo

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!

english.elpais.com/science-tech...