Maura McGrail
@mcgraillab.bsky.social
Zebrafish developmental geneticist, genome engineer, brain development and disease
#zebrafish Does anyone stateside have a ubi:mRFP-CAAX line? Thanks!
April 30, 2025 at 1:51 PM
#zebrafish Does anyone stateside have a ubi:mRFP-CAAX line? Thanks!
Reposted by Maura McGrail
“We report a novel imaging technique using a recently developed clearing reagent called LUCID that makes it possible to capture the complete cellular-resolution 3D structures of larval and juvenile zebrafish.”
New work from Weinstein Lab at NIH 🐟
New work from Weinstein Lab at NIH 🐟
April 8, 2025 at 6:21 PM
“We report a novel imaging technique using a recently developed clearing reagent called LUCID that makes it possible to capture the complete cellular-resolution 3D structures of larval and juvenile zebrafish.”
New work from Weinstein Lab at NIH 🐟
New work from Weinstein Lab at NIH 🐟
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
runx1-2A-creERT2 - Zebrafish Community Cre/lox Resource
KI Name runx1-2A-creERT2 Gene runx1 (ZFIN) ZFIN Gene Page runx1 family transcription factor 1 Lineage blood; HSCs Target Location exon 7 gRNA PAM GACGGCCTCTACAGACATGCTGG Genotype Tg(runx1-2A-creERT2; ...
zebrafishccr.org
April 9, 2025 at 8:45 PM
#zebrafish New runx1-2A-creERT2 KI line now posted on zebrafishccr.org/runx1-2a-cre...
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Beautiful work by genetics PhD student James Preston from the McGrail lab - check it out!
Reposted by Maura McGrail
So long, NIH. The place I grew up in and discovered my passion for science communication.
I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.
I'm so devastated that my whole team got laid off today.
I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.
I'm so devastated that my whole team got laid off today.
April 1, 2025 at 11:01 PM
So long, NIH. The place I grew up in and discovered my passion for science communication.
I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.
I'm so devastated that my whole team got laid off today.
I found a true calling to help take innovative genomics research and make it accessible, interesting and fun for wider audiences.
I'm so devastated that my whole team got laid off today.
#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org
Check out what's available, imaging and information, and make a request.
We're so very grateful to the NIH ORIP for supporting this work!
Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
Check out what's available, imaging and information, and make a request.
We're so very grateful to the NIH ORIP for supporting this work!
Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
Zebrafish Community Cre/lox Resource - Zebrafish Community Cre/lox Resource
Bringing you precision Cre/CreERT2 and floxed lines driven by GeneWeld CRISPR targeted integration. Mission Our mission is to provide the Zebrafish community with Cre resources that open new areas of ...
zebrafishccr.org
April 1, 2025 at 5:52 PM
#zebrafish Our Zebrafish Community Cre/lox Resource is online!! zebrafishccr.org
Check out what's available, imaging and information, and make a request.
We're so very grateful to the NIH ORIP for supporting this work!
Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
Check out what's available, imaging and information, and make a request.
We're so very grateful to the NIH ORIP for supporting this work!
Huge thanks to Parnal Joshi from Iddo Friedberg lab for creating the website!
Zebrafish Community Cre/lox Resource website (ZebrafishCCR) will be online soon!
March 29, 2025 at 6:21 PM
Zebrafish Community Cre/lox Resource website (ZebrafishCCR) will be online soon!
Our DyDy zebrafish hand2-cre and hand2-creERT2 KI paper is online!
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...
Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.
Ready to ship - email requests to mmcgrail@iastate.edu
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...
Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.
Ready to ship - email requests to mmcgrail@iastate.edu
Lineage labeling with zebrafish hand2 Cre and CreERT2 recombinase CRISPR knock‐ins
You have to enable JavaScript in your browser's settings in order to use the eReader.
anatomypubs.onlinelibrary.wiley.com
March 29, 2025 at 6:13 PM
Our DyDy zebrafish hand2-cre and hand2-creERT2 KI paper is online!
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...
Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.
Ready to ship - email requests to mmcgrail@iastate.edu
anatomypubs.onlinelibrary.wiley.com/share/IPCM9K...
Beautiful work Zhitao Ming and Dr. Fang Liu, fantastic collaborators Christian Mosimann, Chunyue Yin and Saulius Sumanas.
Ready to ship - email requests to mmcgrail@iastate.edu