Ensembl
LightNews LightNews
banner
ensembl.org
Ensembl
@ensembl.org
1.2K followers 79 following 100 posts
The Ensembl project seeks to enable genomic science by providing high-quality, integrated annotation.

Vertebrates: www.ensembl.org
Non-vertebrates: www.ensemblgenomes.org

You can test the new Ensembl browser and share your feedback at beta.ensembl.org
Posts Replies Media Videos
Pinned
ensembl.org
Ensembl @ensembl.org · Sep 2
📢 Happy to announce that Ensembl 115 and Ensembl Genomes 62 are out! This release features ~120000 new protein coding transcripts in human GRCh38, 2 new cattle, 7 new plants and 20 new metazoa! 🧬🐮 🫛🪲
Read more here ➡️ zurl.co/poyXM
Ensembl 115 has been released! – Ensembl Blog
zurl.co
ensembl.org
Exciting opportunity to join our team!

Job: Genomics Technology Infrastructure Team Leader
Please follow the instructions in the ad to apply (www.ensembl.info/2026/02/17/...).
Closing date: 25/03/2026
Job: Genomics Technology Infrastructure Team Leader – Ensembl Blog
www.ensembl.info
February 17, 2026 at 2:54 PM
ensembl.org
Ensembl release 116 & Ensembl Genomes release 63 are coming in April 2026!
Read more in our declaration of intentions blog:
www.ensembl.info/2026/02/12/...

From summer 2026, ensembl.org redirects to beta.ensembl.org. Previous versions remain in Ensembl Archives.
February 12, 2026 at 3:45 PM
Reposted by Ensembl
sangerinstitute.bsky.social
If you haven't shared your views on future genomics training & events yet, do it soon for a chance to win. 👀

Once completed, you'll be entered into a prize draw for a chance to win 1 of 3 registration passes (incl. accommodation) to a Connecting Science conference of your choice. 🎉
Link below ⤵️
January 30, 2026 at 4:22 PM
ensembl.org
We are at the Festival of Genomics in London! Join #Ensembl at the “Genome Dome” at 16:00 today to learn about latest new genomes and annotations available via beta.ensembl.org

#FOG2026
Photographs of the Festival of Genomics banner and Genome Dome session agenda.
January 28, 2026 at 9:46 AM
ensembl.org
Get to know the people behind Ensembl and meet Disha Lodha from the Ensembl Plants & Metazoa team in our latest #Teamsembl blog post at www.ensembl.info/2026/01/27/...
January 27, 2026 at 1:55 PM
ensembl.org
Exciting opportunity at Ensembl!
We’re hiring a Bioinformatics developer to contribute to the development of the Ensembl Variant Effect Predictor (VEP).
More info: www.ensembl.info/2026/01/22/...
#Jobs #bioinformatics
Job: Bioinformatics Developer – Ensembl Blog
www.ensembl.info
January 26, 2026 at 1:46 PM
Reposted by Ensembl
embl.org
Recruitment for the EMBL International PhD Programme is officially open! 🔊

At EMBL, we train young scientists to become skilled and creative future leaders in academia, industry and other sectors. Start your career in the life sciences with us!

🔎 Read more here:
tinyurl.com/4jdt2ra5
January 26, 2026 at 8:50 AM
ensembl.org
Exciting opportunity at Ensembl!
We’re hiring a Bioinformatician to help drive large-scale genomics and generate gene annotation for GENCODE or PARADIGM.
More info: www.ensembl.info/2026/01/05/...
Job: Bioinformatician – Ensembl Blog
www.ensembl.info
January 14, 2026 at 11:53 AM
ensembl.org
Service notice - we are working on server issues affecting the Ensembl mirror sites. Workaround - ensembl.org?redirect=no or an archive may2025.archive.ensembl.org/. You can try the new Ensembl site at beta.ensembl.org and let us know about the features you would like to see!
January 13, 2026 at 11:20 PM
ensembl.org
How can animal genomics communities coordinate data resources? Garth Ilsley presents with highlights from the FAANG and Ensembl Regulation data portals #PAG33
January 13, 2026 at 10:09 PM
ensembl.org
Uniprot @uniprot is developing new strategies and workflows for reference proteomes of agricultural species - Pedro Raposo presents at #PAG33
January 11, 2026 at 6:57 PM
ensembl.org
Elspeth Bruford presents on gene naming by the HUGO gene nomenclature committee, over 44000 genes named to date! “Nomenclature should not be offensive or pejorative”! @hgnc.bsky.social #PAG33
January 11, 2026 at 6:38 PM
ensembl.org
New long transcriptomic data are introducing complexities and opportunities into manual genome annotation! Jane Loveland @janeloveland.bsky.social shares new insights @gencodegenes.bsky.social #PAG33
January 11, 2026 at 6:07 PM
ensembl.org
José Pérez-Silva @jgperezsilva.bsky.social presents on gene annotation methods used by Ensembl at #PAG33
January 11, 2026 at 5:37 PM
ensembl.org
If you're in sunny San Diego for #PAG33, join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics!

It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!
January 9, 2026 at 11:31 PM
ensembl.org
New #GeneAnnotation has been added to #Ensembl Beta, including annotation for Dasypus novemcinctus and Buteo buteo!
You can explore all available species here: beta.ensembl.org/species-sel...

Image credits:
commons.wikimedia.org/wiki/F...
commons.wikimedia.org/wiki/F...
Photographs of the nine-banded armadillo and common buzzard.
January 8, 2026 at 4:15 PM
ensembl.org
Hello, happy New Year!

Three roles are currently open at Ensembl:

Genomic Data Analyst
Closing date: 10 Jan 2026

Genomic Data Analyst Project Lead
Closing date: 10 Jan 2026

Senior Platform Developer
Closing date: 24 Jan 2026

More info on current vacancies here (www.ensembl.info/category/06-...)
Jobs @ Ensembl – Ensembl Blog
www.ensembl.info
January 5, 2026 at 1:30 PM
Reposted by Ensembl
gencodegenes.bsky.social
The HAVANA team at EMBL-EBI has multiple open positions to support the GENCODE and PARADIGM projects. We're recruiting gene annotators (bit.ly/4qG28g5), an annotation project lead (bit.ly/4qv05v6), and bioinformaticians (bit.ly/4qevYIY). Please apply via the links. We’d love to hear from you!
Genomic Data Analyst
About the Team The HAVANA team, part of Ensembl, produces reference-quality gene annotation for the human and mouse genomes as a core contributor to the GENCODE project, a Global Core Biodata Resource...
embl.wd103.myworkdayjobs.com
January 5, 2026 at 12:55 PM
ensembl.org
Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?
December 25, 2025 at 10:29 AM
ensembl.org
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.
December 25, 2025 at 9:10 AM
ensembl.org
Ensembl Job alert! Bioinformatics Developer in Ensembl Compara
Apply here: www.ensembl.info/2025/12/10/...
Closing date: 12 January 2026
Job: Bioinformatics Developer Ensembl Compara – Ensembl Blog
www.ensembl.info
December 10, 2025 at 10:06 AM
Reposted by Ensembl
opentargets.org
#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️
Graphic with a 10 surrounded by fireworks and the Open Targets Platform logo
December 8, 2025 at 10:21 AM
ensembl.org
In Nov, @aleenamolbio.bsky.social from Ensembl Outreach visited Uni Valle Colombia to introduce 100 students from 3 public schools in Valle del Cauca to EMBL-EBI research & open-access bioinformatics training. Inspiring the next generation of scientists! 🌱🔬 #STEM #Bioinformatics #Outreach
December 5, 2025 at 4:49 PM
ensembl.org
Attention developers and researchers working with Ensembl programmatically! Upcoming Ensembl API and data access changes are live on our blog. Read more about the new platform, new services, and migration timelines here: www.ensembl.info/2025/12/02/...
December 2, 2025 at 5:03 PM
ensembl.org
Our Ensembl 2026 paper is out!
Learn about 1,900+ new genomes, expanded pangenome support, new regulation interfaces, and what’s coming in our 2026 releases.
doi.org/10.1093/nar/gkaf1239
Ensembl 2026
Abstract. The Ensembl project (https://www.ensembl.org) is a public and open resource providing access to genomes, annotations, high-quality tools, and met
academic.oup.com
November 28, 2025 at 4:30 PM