Ensembl
banner
ensembl.org
Ensembl
@ensembl.org
The Ensembl project seeks to enable genomic science by providing high-quality, integrated annotation.

Vertebrates: www.ensembl.org
Non-vertebrates: www.ensemblgenomes.org

You can test the new Ensembl browser and share your feedback at beta.ensembl.org
Pinned
📢 Happy to announce that Ensembl 115 and Ensembl Genomes 62 are out! This release features ~120000 new protein coding transcripts in human GRCh38, 2 new cattle, 7 new plants and 20 new metazoa! 🧬🐮 🫛🪲
Read more here ➡️ zurl.co/poyXM
Ensembl 115 has been released! – Ensembl Blog
zurl.co
Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?
December 25, 2025 at 10:29 AM
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.
December 25, 2025 at 9:10 AM
Ensembl Job alert! Bioinformatics Developer in Ensembl Compara
Apply here: www.ensembl.info/2025/12/10/...
Closing date: 12 January 2026
Job: Bioinformatics Developer Ensembl Compara – Ensembl Blog
www.ensembl.info
December 10, 2025 at 10:06 AM
Reposted by Ensembl
#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️
December 8, 2025 at 10:21 AM
In Nov, @aleenamolbio.bsky.social from Ensembl Outreach visited Uni Valle Colombia to introduce 100 students from 3 public schools in Valle del Cauca to EMBL-EBI research & open-access bioinformatics training. Inspiring the next generation of scientists! 🌱🔬 #STEM #Bioinformatics #Outreach
December 5, 2025 at 4:49 PM
Attention developers and researchers working with Ensembl programmatically! Upcoming Ensembl API and data access changes are live on our blog. Read more about the new platform, new services, and migration timelines here: www.ensembl.info/2025/12/02/...
December 2, 2025 at 5:03 PM
Our Ensembl 2026 paper is out!
Learn about 1,900+ new genomes, expanded pangenome support, new regulation interfaces, and what’s coming in our 2026 releases.
doi.org/10.1093/nar/gkaf1239
Ensembl 2026
Abstract. The Ensembl project (https://www.ensembl.org) is a public and open resource providing access to genomes, annotations, high-quality tools, and met
academic.oup.com
November 28, 2025 at 4:30 PM
New datasets available on beta.ensembl.org! Highlights include oats from the PanOat project, human assemblies from HPRC Release 2 and the pocket water lily, submitted by
Fujian Agriculture and Forestry University
Image credit - commons.wikimedia.org/wiki/F...
November 18, 2025 at 2:59 PM
Reposted by Ensembl
New Webinar: This Wednesday, join speakers Jorge Barista da Rocha, PhD, and Jane Loveland, PhD, as they explore the @ensembl.org genome browser and provide practical skills beyond the traditional reference genome. Register here: bit.ly/432kP4b #ASHG #HumanGenetics @gencodegenes.bsky.social
November 17, 2025 at 5:02 PM
Reposted by Ensembl
Antimicrobial resistance (AMR) is a growing health threat, making infections harder to treat and complicating routine medical care.

EMBL-EBI’s new AMR portal brings together laboratory resistance data and bacterial genomes in one open platform.

#WAAW2025 #ActOnAMR

www.ebi.ac.uk/about/news/t...
🧬💻
A new gateway to global antimicrobial resistance data
New online portal connects bacterial genomes with experimental resistance data to support antimicrobial resistance research.
www.ebi.ac.uk
November 18, 2025 at 9:59 AM
Ensembl job alert! We are looking for a bioinformatics developer to join our Genebuild team: zurl.co/QpnKj
Closing date: 11 Dec 2025
Job: Bioinformatics Developer – Ensembl Genebuild – Ensembl Blog
zurl.co
November 14, 2025 at 2:36 PM
Join us tomorrow to explore Ensembl resources for pangenomes! Leanne Haggerty is presenting on Ensembl annotation for human, model organism, livestock & crop plant pangenomes.

Free registration: zurl.co/3sSUJ 

Full series:zurl.co/XrVdc
#Pangenomes #Ensembl
November 11, 2025 at 3:20 PM
Reposted by Ensembl
🚨 NEWS! The GWAS Catalog Diagram is back up! 🚨
Smoother, faster loading for filtered views!
🗺️ Explore now 👉 www.ebi.ac.uk/gwas/diagram
Tell us what you think! Are there any features you would like? Help us to make it useful for the #gwas community
November 5, 2025 at 3:59 PM
As new human assemblies become available on beta.ensembl.org - which human reference genome will you choose? This article explores the question with insights from Ensembl’s own Fergal Martin - www.nature.com/articles/s41...

#HumanGenomics #Pangenomes #ReferenceGenomes
Choose your human genome reference wisely - Nature Methods
Scientists can choose between multiple human genome references, and a pangenome reference is coming. Deciding what to use when is not quite straightforward.
www.nature.com
November 4, 2025 at 12:28 PM
Last day to add your input for #phytopathogen genome resources! Complete the survey before it closes: qualtricsxmpy46tq866.qualtrics.com/jfe/form/SV_...
October 31, 2025 at 3:42 PM
Reposted by Ensembl
📣Advance your skills in #pathogen genomics — no coding required — with the #Fungal Pathogen Genomics (Virtual) course #FungiDB @ensembl.org #mycocsm @yeastgenome.bsky.social #CGD
🗓️ 1–5 June 2026 Deadline: 16 March 2026
Apply here: coursesandconferences.wellcomeconnectingscience.org/event/fungal...
October 29, 2025 at 2:43 PM
Ensembl Beta 14 is now live! We've added many more genomes, including Uroteuthis edulis, the Swordtip squid from the Aquatic Symbiosis Project. Find out if your favourite species is available with Ensembl Beta's Species Selector: zurl.co/BRLSE

#Ensembl #NewRelease
October 16, 2025 at 3:07 PM
FungiDB/VEuPathDB + Ensembl are teaming up to enhance fungal & oomycete genome resources — and we need your input!

Complete the survey by Nov 1st, 2025: 
zurl.co/gKjC1

Your feedback will help guide decisions on genome curation, annotation & data integration.
Qualtrics Survey | Qualtrics Experience Management
The most powerful, simple and trusted way to gather experience data. Start your journey to experience management and try a free account today.
zurl.co
October 15, 2025 at 1:49 PM
Introducing Ada: the new AI assistant from EMBL-EBI Training. We created our training chatbot, Ada, to make it easier and more engaging for users to find the right on-demand training resources from our broad catalogue of training: www.ebi.ac.uk/training/ada

#AdaLovelaceDay #bioinformatics

🧬🖥️
October 14, 2025 at 1:26 PM
Notice for users of Ensembl Rapid Release - this site has been archived and is now accessible at rapid-archive.ensembl.org. Any saved URLs will now redirect to the latest data on our new site- beta.ensembl.org

Learn more on our blog: www.ensembl.info/2025/10/13/...
October 13, 2025 at 3:37 PM
Cool update in Ensembl VEP (release 115):
You can now annotate structural variants with @gnomad-project.bsky.social allele frequencies AND ClinVar clinical significance

Perfect for filtering & interpreting SVs!
More info on our blog (zurl.co/3lZjy)
#genomics #bioinformatics
Cool stuff Ensembl VEP can do: annotate structural variants with gnomAD allele frequencies and ClinVar clinical significance – Ensembl Blog
zurl.co
October 10, 2025 at 1:55 PM
Reposted by Ensembl
So, our definitive paper on the human reference gene set is out this week in Database (Oxford).

We merged and compared @ensembl.org / @gencodegenes.bsky.social , RefSeq and UniProtKB coding genes and investigated the agreements and discrepancies.

Details of what we found in the thread ...
September 30, 2025 at 2:25 PM
Thank you very much Manovikas Kendra Kolkata for hosting our Ensembl Genome Browser and Train the Trainer workshops!

I enjoyed learning about the neurodiversity research done here and it was great to see how it is readily applied to improving patient's lives!
September 25, 2025 at 1:24 PM
Ensembl VEP makes variant annotation easy with access to key reference data for filtering and interpretation. Now includes MAVE results, offering further insights across nearly all possible variants in targeted regulatory or coding regions. More on our blog (zurl.co/Aj9HH)
#bioinformatics #genomics
September 24, 2025 at 12:21 PM
Ensembl is in Kolkata! 🇮🇳 we connected with researchers at #incob2025 in a workshop about our new Ensembl site - beta.ensembl.org!

Thank you to all who attended for your great questions and to the organisers for this great event! - www.apbionet.org jcbose.ac.in/home
September 19, 2025 at 5:15 AM