Elle McD
iimabeans.bsky.social
Elle McD
@iimabeans.bsky.social
i like sad music and cool looking rocks~ 😎
educator | cardgame enthusiast | tired 👉🏳️‍⚧️👈
Reposted by Elle McD
I'M LIVE RIGHT NOW, DONATE FOR TRANS RIGHTS
Here is the current schedule for tomorrow's stream!!! I will be on all day, and Emily will be on and off intermittently! See you tomorrow at 10 am PST— donations are already open! www.youtube.com/live/iQ1FbkI...
January 28, 2025 at 12:10 AM
either I got really lucky again or TSA agents are getting really good at sniffing out trans people I got to skip the penis-detection-machine TWO TIMES IN A ROW 🫡🥹🥳

patdownless vacation would you believe it
December 27, 2024 at 10:20 PM
fish oil pill was extra sloppy this morning and I had to physically restrain myself from popping it like a gushers between my fingers
December 26, 2024 at 7:05 PM
*two prokaryotes in 3,700,000,000 BC*

what if we kissed in the primordial stew...
December 14, 2024 at 11:12 PM
who's going to stop me from putting buzzcut season by Lorde on every playlist I own in the year 2024(5)???
December 14, 2024 at 1:41 AM
my students won't stop asking where the fresh blood sample for our lab is coming from. I'm gonna keep not telling them and keep showing up to school with more bandaids on my fingers until they figure it out
December 12, 2024 at 10:51 PM
took my estrogen and got a goodnight kiss. everything is okay now
December 9, 2024 at 4:49 AM
my stupid dog won't stop reciting the Kybalion when I try to cut his hair,,,
I know you're excited about planar vibration frequencies LET ME TRIM YOUR MUSTACHE PLEASE
December 7, 2024 at 8:43 PM
incredible how putting on makeup turns a bad day into a bad day with makeup on
December 7, 2024 at 3:02 AM
she sequence on my genome till I ATGGCGATCCTAGGTCATGC
December 2, 2024 at 7:30 PM
I know two authors who told me to buy their book in any way OTHER than using Amazon because it earns them the least money.

Shop local and support indie authors!
November 30, 2024 at 5:59 PM
Reposted by Elle McD
i wish there was a song for those of us who are not sick, yet arent entirely well either
November 30, 2024 at 4:59 AM
engineers be like: *employed*
November 28, 2024 at 7:41 PM
every time Drew Polovick writes a bass line a really cool bug gets its wings

anyways I'm learning Spectator by FPC right now
November 27, 2024 at 7:27 PM
sorry I couldn't help unload the groceries I was holding space for the lyrics of defy gravity
November 27, 2024 at 5:25 PM
Reposted by Elle McD
November 27, 2024 at 10:49 AM
silly string is just regular string to me
November 27, 2024 at 5:52 AM