If they turn Kernan they’re cooked

Call for Schumer and Jeffries to step down so actual leadership can be seen

please lose your primary

they have columbo

navigating piles of trash to get to every episode of columbo has speakeasy vibes

Realizing anytime I heard Country Roads I was being exposed to this fact without even knowing it

for universal translation:
agccacgagcacgagagaacccacgagtacacccacgagatgcacgagcacatcatgatcaccatcaccagc

does anyone have a primer or cypher or decoder ring to figure out the author of the posts that are obviously not written by Trump?

Meowth of the south

running out of places to buy groceries

ive never understood why they think they will keep getting bribes the more power they give up to the executive. its gotta be cheaper to bribe one guy rather than 40 something. or they also know this and are trying to cash in now

do they think Florida kids (if they survive to be old enough to go to college) will be welcomed into Harvard et al unvaccinated?

people forgot too quickly about the weird bench photoshop